View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5017_high_6 (Length: 421)
Name: NF5017_high_6
Description: NF5017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5017_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 293; Significance: 1e-164; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 39 - 418
Target Start/End: Complemental strand, 21272683 - 21272296
Alignment:
| Q |
39 |
ttttttatccttttcatttggctattgttctggtaattgcaaatactaaaatacatacacatcattgagggggaaatatggcgaccgagatttgaacttg |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
21272683 |
ttttttatccttttcatttggctattgttctcgtaattgcaaatactaaaatacatacgcatcattgaggag-aaatatggcgaccgagatttgaacttg |
21272585 |
T |
 |
| Q |
139 |
aaattttacaaaaattttgtatttaaattgagtacaataactctaaccctattaacgatgtgctttttcagagtcagagtaataggttgtgaatataggt |
238 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21272584 |
aaattttacaaaaattttgtatttgaattgagtacaatagctctaaccctattaacaatgtgctttttcagagtcagagtaataggttgtgaatataggt |
21272485 |
T |
 |
| Q |
239 |
catatctctcttggaagtgttagatgtatgtttttagggggattaccctaga---------aacggctcctcctagtctccccatgatcccccttctttc |
329 |
Q |
| |
|
||| ||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
21272484 |
catgcctctcttggaagtgtcagatgtatgtttttagggggattaccctagaaggaatcggaacggctcctccaagtctccccatgatcccccttctttc |
21272385 |
T |
 |
| Q |
330 |
cgcctttccctcctctattttaggcacacaatgccttggtgggaagactaagtcgaggatgacttggacccttggacctatgtttctgc |
418 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
21272384 |
cgcctttccctactctattttaggcacacaatgccctagtgggaagactaagtcgaggatgacttggacccttggacctaagtttctgc |
21272296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 168 - 241
Target Start/End: Complemental strand, 49764527 - 49764454
Alignment:
| Q |
168 |
gagtacaataactctaaccctattaacgatgtgctttttcagagtcagagtaataggttgtgaatataggtcat |
241 |
Q |
| |
|
|||||||||| ||||||||||| || | ||||||||| |||||||||||| ||||| ||||||||||||||| |
|
|
| T |
49764527 |
gagtacaatagctctaaccctagtagcagtgtgcttttcgagagtcagagtagtaggtagtgaatataggtcat |
49764454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 48; Significance: 3e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 305 - 408
Target Start/End: Complemental strand, 18654597 - 18654494
Alignment:
| Q |
305 |
gtctccccatgatcccccttctttccgcctttccctcctctattttaggcacacaatgccttggtgggaagactaagtcgaggatgacttggacccttgg |
404 |
Q |
| |
|
||||| ||| ||| ||||||||| |||||||| |||||| |||||||||||| |||| | ||||| |||||||||||| ||||||||||||||||| | |
|
|
| T |
18654597 |
gtctctccacgatgccccttcttcccgccttttcctccttgattttaggcacataatgaccaggtggaaagactaagtcggggatgacttggacccttag |
18654498 |
T |
 |
| Q |
405 |
acct |
408 |
Q |
| |
|
|||| |
|
|
| T |
18654497 |
acct |
18654494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 197 - 240
Target Start/End: Original strand, 10325370 - 10325413
Alignment:
| Q |
197 |
tgtgctttttcagagtcagagtaataggttgtgaatataggtca |
240 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||| ||||||| |
|
|
| T |
10325370 |
tgtgctttttcagagtcagagtgataggtagtgaatttaggtca |
10325413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University