View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5018-Insertion-10 (Length: 208)
Name: NF5018-Insertion-10
Description: NF5018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5018-Insertion-10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 19 - 200
Target Start/End: Original strand, 39150953 - 39151138
Alignment:
| Q |
19 |
agaagcattcagggacatagcatctgcacctttctagctatactcaaattgaatatacatgctcactcaacaagtgttcatgatcttttgaacttagttg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39150953 |
agaagcattcagggacatagcatctgcacctttctagctatactcaaattgaatatacatgctcactcaacaagtgttcatgatcttttgaacttagttg |
39151052 |
T |
 |
| Q |
119 |
tagcttgtac----atatatatatagtatgccatatgataccatacgggatgaaattttgggtttccaacaattattttttatcat |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
39151053 |
tagcttgtacatatatatatatatagtatgccatatgataccatacgggatgaaattttgggtttccaacaattattatttatcat |
39151138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University