View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5018-Insertion-9 (Length: 391)
Name: NF5018-Insertion-9
Description: NF5018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5018-Insertion-9 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 8e-74; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 8e-74
Query Start/End: Original strand, 186 - 391
Target Start/End: Original strand, 23344737 - 23344941
Alignment:
| Q |
186 |
tagtaaaatttgtttaaagatacaattagaataatgaaaaaactaatccaagatactctcttctttaannnnnnnnnaaaatatataattaggataatgt |
285 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||| |||||||||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
23344737 |
tagtaaaatttatttaaagatacaattaggatattgaaaaaactaatccaagatactctcttctttaaatttgtatcaa--tatataattaggataatgt |
23344834 |
T |
|
| Q |
286 |
aaaaagcaacctaaa-tactctcttgattaggaattgcaatgcagtattcatcaattgatgaaatctttatcatcatactactagaaattcctgattttc |
384 |
Q |
| |
|
||||||||||||||| |||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23344835 |
aaaaagcaacctaaaatactctcttgatgatgaattgcaatgcagtattcatcaattgatgaaatctttatcatcatactactagaaattcctgattttc |
23344934 |
T |
|
| Q |
385 |
atgtgga |
391 |
Q |
| |
|
||||||| |
|
|
| T |
23344935 |
atgtgga |
23344941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 8 - 53
Target Start/End: Original strand, 23338710 - 23338755
Alignment:
| Q |
8 |
ctaatgggtgcaacattatatactagtagcggcaacacaagagcta |
53 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23338710 |
ctaatgggagcaacattatatactagtagcggcaacacaagagcta |
23338755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 190 - 226
Target Start/End: Original strand, 3955908 - 3955944
Alignment:
| Q |
190 |
aaaatttgtttaaagatacaattagaataatgaaaaa |
226 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
3955908 |
aaaatttgtttaaaggtacaattggaataatgaaaaa |
3955944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University