View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5018_high_16 (Length: 315)
Name: NF5018_high_16
Description: NF5018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5018_high_16 |
 | |
|
| [»] scaffold0006 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0006 (Bit Score: 128; Significance: 4e-66; HSPs: 1)
Name: scaffold0006
Description:
Target: scaffold0006; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 17 - 204
Target Start/End: Original strand, 82561 - 82750
Alignment:
| Q |
17 |
actagagaattaccgagatagaaggagaattacatcacaca----tacttcataaccctttttctcatctctttgtaagatatctacccatgtagtcact |
112 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| || |||||||||||| |||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
82561 |
actagagaattagtgagatagaaggagaattacatcactcacgcatacttcataaccatttttctcatctctttgtaagatatctacccatgtagtcaat |
82660 |
T |
|
| Q |
113 |
aaaatgtgatggttatctttaggaatacagttgtttcttctaacagtttgttgtacaaggcccacgttacctgcctgaatcaacggccacat |
204 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||| |||||||| |
|
|
| T |
82661 |
aaaatgtgatggttatgtttaggaatacagttgtttcttctaacagtttgttgt--gatgcccacgttacctgcctgaatcaatggccacat |
82750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University