View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5018_high_22 (Length: 246)
Name: NF5018_high_22
Description: NF5018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5018_high_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 122; Significance: 1e-62; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 17 - 158
Target Start/End: Original strand, 27644828 - 27644969
Alignment:
| Q |
17 |
aggattgaaccgttgccatctcctttgcaattgagggtttgactttgaaaacgacgttgtcggaggtgatgagtgagatcattgtttctgagagggagag |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||| |
|
|
| T |
27644828 |
aggattgaaccgttgccatctcctttgcaattgagggtttgactttgaaaacgacgttgtcggaggtgatgagtgagatcattgtttctgagatggtgag |
27644927 |
T |
 |
| Q |
117 |
tttgttcatctccgatgaaatttgttgttctgccattgtttc |
158 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
27644928 |
tttgttcatctccgatgaaacttgttgttccaccattgtttc |
27644969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 21 - 155
Target Start/End: Original strand, 27549328 - 27549462
Alignment:
| Q |
21 |
ttgaaccgttgccatctcctttgcaattgagggtttgactttgaaaacgacgttgtcggaggtgatgagtgagatcattgtttctgagagggagagtttg |
120 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |||||||| ||| || |
|
|
| T |
27549328 |
ttgaaccgttcccatctcctttgcaattgagggtttgactttgaaaacgacgttgtcagaggttatgagtgagatcattgtttcggagagggatagtgtg |
27549427 |
T |
 |
| Q |
121 |
ttcatctccgatgaaatttgttgttctgccattgt |
155 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||| |
|
|
| T |
27549428 |
ttcatctctgatgaaacttgttgttctgccattgt |
27549462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 96 - 158
Target Start/End: Original strand, 27549457 - 27549516
Alignment:
| Q |
96 |
cattgtttctgagagggagagtttgttcatctccgatgaaatttgttgttctgccattgtttc |
158 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
27549457 |
cattgtctctgagagggagagtgtgttcatctctgatgaaa---attgttctgccattgtttc |
27549516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University