View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5018_high_26 (Length: 236)
Name: NF5018_high_26
Description: NF5018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5018_high_26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 19 - 221
Target Start/End: Complemental strand, 47306456 - 47306253
Alignment:
| Q |
19 |
atgaagaccttaacaagtaaatgaaataagcaaaacaatg-ttaattgaaaagaaaattcagaaattcattactacaaattccttgcttctttagctata |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
47306456 |
atgaagaccttaacaagtaaatgaaataagcaaaacaatggttaattgaaaagaaaattcagaaattcattgctacaatttccttgcttctttagctata |
47306357 |
T |
|
| Q |
118 |
gatattgaattaattcaaccgaaaaaacaaaacaataattgaatgaaagtgaagtaggtagggtaggtaccttgccgtcgggatgaaaacaagggtggat |
217 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47306356 |
gatattgaatttcttcaaccgaaaaaacaaaacaataattgaatgaaagtgaagtaggtagggtaggtaccttgccgtcgggatgaaaacaagggtggat |
47306257 |
T |
|
| Q |
218 |
gatg |
221 |
Q |
| |
|
|||| |
|
|
| T |
47306256 |
gatg |
47306253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University