View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5018_high_29 (Length: 215)
Name: NF5018_high_29
Description: NF5018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5018_high_29 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 8e-85; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 16 - 198
Target Start/End: Complemental strand, 10865054 - 10864872
Alignment:
| Q |
16 |
caccaccatgggtcgtttttcaaggtcatcctttctcttttcttccagtttccatcagctccgtcgtcagttttcgtcggagtcggagtcagtgaaacgg |
115 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
10865054 |
caccaccatgggtcgtttttcaaggtcctcctttctctcttcttccagtttccagcagctccgtcgtcagttttcgtcggagtcgcagtcagtgaaacgg |
10864955 |
T |
|
| Q |
116 |
gtgcgcaacatatggatctcggggctgatcgaccctgaaaaggtgacccagacagagaggtcgttgttatacgagggtgatat |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
10864954 |
gtgcgcaacatatggatctcggggctgatcgaccctgaaaaggtgacccagagagagaggtcgttgttatatgagggtgatat |
10864872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 16 - 141
Target Start/End: Complemental strand, 10851500 - 10851375
Alignment:
| Q |
16 |
caccaccatgggtcgtttttcaaggtcatcctttctcttttcttccagtttccatcagctccgtcgtcagttttcgtcggagtcggagtcagtgaaacgg |
115 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||| ||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
10851500 |
caccaacatgggtcgtttttcaaggtcctcctttctctcttcttccagtttccagcagctccgccgtcagttttcgtcggagtcggagtcagtgaaacgg |
10851401 |
T |
|
| Q |
116 |
gtgcgcaacatatggatctcggggct |
141 |
Q |
| |
|
||||| ||||||||||| |||||||| |
|
|
| T |
10851400 |
gtgcggaacatatggatatcggggct |
10851375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 16 - 141
Target Start/End: Complemental strand, 10879002 - 10878877
Alignment:
| Q |
16 |
caccaccatgggtcgtttttcaaggtcatcctttctcttttcttccagtttccatcagctcc---gtcgtcagttttcgtcggagtcggagtcagtgaaa |
112 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |||| |||||||| ||||||| |||||||||||||||| |||||| |||||||||| |
|
|
| T |
10879002 |
caccaccatgggtcgtttttcaaggtcctcctttctct---cttcaagtttccagcagctcctccgtcgtcagttttcgtcagagtcgtcgtcagtgaaa |
10878906 |
T |
|
| Q |
113 |
cgggtgcgcaacatatggatctcggggct |
141 |
Q |
| |
|
|||||||| ||||||||||| |||||||| |
|
|
| T |
10878905 |
cgggtgcggaacatatggatatcggggct |
10878877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University