View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5018_low_14 (Length: 337)
Name: NF5018_low_14
Description: NF5018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5018_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 327
Target Start/End: Complemental strand, 31573267 - 31572942
Alignment:
| Q |
1 |
ttaaagtgccatgatttttgcattactaataggaaaataatttttggacaccga-tttctcacnnnnnnnnnatatagataggaaataggttttggtggt |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| ||||||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
31573267 |
ttaaagtgccatgatttttgcattactaatgggaaaataaattttggacaccgaatttctcactttttttttatatagataggaaataggttttggtggt |
31573168 |
T |
 |
| Q |
100 |
annnnnnngtggtacagtagaaaatagccactatatccatacgagtagtactgctagcataaccctgactaggtcatgctgtgctagcctcactccttcc |
199 |
Q |
| |
|
| ||||||||||| ||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31573167 |
atttttttgtggtacagtaaaaaatagccgctatatccatacaagtagtactgctagcataaccctgactaggtcatgctgtgctagcctcactccttcc |
31573068 |
T |
 |
| Q |
200 |
tatttggagaccaatatatcatcaaagttacctaccttcttctcataggcagcaaaattcaggtgagtatatattgttaacttctcgttcttacgtgtta |
299 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31573067 |
tatttggagaccaatat--catctaagttacctaccttcttctcataggcagcaaaattcaggtgagtatatattgttaacttctcgttcttacgtgtta |
31572970 |
T |
 |
| Q |
300 |
gcataatataatattgtatatctgatga |
327 |
Q |
| |
|
||||||| |||||||||||||||||||| |
|
|
| T |
31572969 |
gcataatgtaatattgtatatctgatga |
31572942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 159 - 204
Target Start/End: Original strand, 38348544 - 38348589
Alignment:
| Q |
159 |
taaccctgactaggtcatgctgtgctagcctcactccttcctattt |
204 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
38348544 |
taaccttgactaggtcatgctgtgacagcctcactctttcctattt |
38348589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University