View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5018_low_18 (Length: 309)
Name: NF5018_low_18
Description: NF5018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5018_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 272; Significance: 1e-152; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 14 - 293
Target Start/End: Complemental strand, 50967994 - 50967715
Alignment:
| Q |
14 |
gagttggtggtaacacactggggaaacacccttgattacaaaaagggttctgagttggaagctgtgaaactatcaagttttatttcttcgtcacatgcca |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50967994 |
gagttggtggtaacacactggggaaacacccttgattacaaaaagagttctgagttggaagctgtgaaactatcaagttttatttcttcgtcacatgcca |
50967895 |
T |
 |
| Q |
114 |
catgcttcctttggtcgatcacaaagatatgttttttagacaaccgtgatttccttgattaatcaactcaagccgtatgtccactgtcaaattattatca |
213 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50967894 |
catgcttcctttggttgatcacaaagatatgttttttagacaaccgtgatttccttgattaatcaactcaagccgtatgtccactgtcaaattattatca |
50967795 |
T |
 |
| Q |
214 |
taaggtaccttattgaaacatcttacatacacagagtttgcctcattatctattttattaaacatatatgtgcagtgtgt |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50967794 |
taaggtaccttattgaaacatcttacatacacagagtttgcctcattatctattttattaaacatatatgtgcagtgtgt |
50967715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 159 - 224
Target Start/End: Original strand, 52629916 - 52629979
Alignment:
| Q |
159 |
gtgatttccttgattaatcaactcaagccgtatgtccactgtcaaattattatcataaggtacctt |
224 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||| | ||| ||||||| ||||||||||||| |
|
|
| T |
52629916 |
gtgatttccttgattaatcaacttaag--ttatgtccattttcacattattaacataaggtacctt |
52629979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University