View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5018_low_19 (Length: 288)
Name: NF5018_low_19
Description: NF5018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5018_low_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 7 - 271
Target Start/End: Complemental strand, 5661523 - 5661258
Alignment:
| Q |
7 |
tagattatacttatctcacataccaattctaaattatcgggacatctctccctaaatcaggagggttaacnnnnnnnn--tatgattgtttgttctacta |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||| ||| |
|
|
| T |
5661523 |
tagattatacttatctcacataccaattctaaattatcgggacatctttccctaaatcaggagggttaacacaaaaaaaatatgattgtttgttctgcta |
5661424 |
T |
|
| Q |
105 |
aaaattgatggcattttgtaacccagaggagttacttgnnnnnnnnnggttacatgataaattacttgttaacacaaggcaacaactgttttttaaatta |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5661423 |
aaaattgatggcattttgtaacccagaggagttacttgtttttttt-ggttacatgatgaattacttgttaacacaaggcaacaactgttttttaaatta |
5661325 |
T |
|
| Q |
205 |
taaaagattaaagcaatcgcaaaaggttctaagaaacacaaaagtgagatctcttagcaataaaggt |
271 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
5661324 |
taaaagattaaagcaatcgcaataggttctaggaaacacaaaagtgagatctcttagcaataaaggt |
5661258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University