View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5018_low_20 (Length: 277)
Name: NF5018_low_20
Description: NF5018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5018_low_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 12 - 144
Target Start/End: Complemental strand, 4704206 - 4704074
Alignment:
| Q |
12 |
ttaattcaaaagcttcattattcaatatatactcttccacttatataaaaaacttgtttgtttagagcataagtaggtgaatatggttagtatctgtgag |
111 |
Q |
| |
|
|||||| ||| ||||||| ||||| ||||||| || ||||||| | | |||||||||| ||||| |||| |||||||||| | | | ||||||||||| |
|
|
| T |
4704206 |
ttaattaaaaggcttcatggttcaacatatacttttacacttatgttataaacttgtttatttagtgcatgagtaggtgaagagagatggtatctgtgag |
4704107 |
T |
 |
| Q |
112 |
tttcaaaagattttgttcactttccctccaatt |
144 |
Q |
| |
|
||| |||||||| ||||| ||||||||| |||| |
|
|
| T |
4704106 |
tttgaaaagattgtgttccctttccctcaaatt |
4704074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 222 - 260
Target Start/End: Complemental strand, 4703098 - 4703060
Alignment:
| Q |
222 |
agtaggagacaagttagctatactgtgctgaaatgttca |
260 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4703098 |
agtaggagagaagttagctatactgtgctgaaatgttca |
4703060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University