View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5018_low_25 (Length: 239)
Name: NF5018_low_25
Description: NF5018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5018_low_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 31573352 - 31573573
Alignment:
| Q |
1 |
tataaccaaacctagatcatgctggcagcttcactttttcctttgtgatcataacaatattgctattgagtgatttacaggtatatatatggttttgttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31573352 |
tataaccaaacctagatcatgctggcagcttcactttttcctttgtgatcataacaatattgctgttgagtgatttgcaggtatatatatggttttgttt |
31573451 |
T |
 |
| Q |
101 |
tgttacaacaaagaaacagtatggtagcactcacttagaaccactaaagacaaagagaggaatattttagatcaaactaacacttgggacaagtttcatg |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31573452 |
tgttacaacaaagaaacagtatgttagcactcacttagaaccacaaaagacaaagagaggaatattttagatcaaactaacacttgggacaagtttcatg |
31573551 |
T |
 |
| Q |
201 |
tcaaaactgtatagtaacataa |
222 |
Q |
| |
|
|||||||||| ||||||||||| |
|
|
| T |
31573552 |
tcaaaactgtctagtaacataa |
31573573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 13 - 48
Target Start/End: Complemental strand, 38348489 - 38348454
Alignment:
| Q |
13 |
tagatcatgctggcagcttcactttttcctttgtga |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
38348489 |
tagatcatgctggcagcttcactttttcctttgtga |
38348454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University