View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5018_low_27 (Length: 236)

Name: NF5018_low_27
Description: NF5018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5018_low_27
NF5018_low_27
[»] chr7 (1 HSPs)
chr7 (19-221)||(47306253-47306456)


Alignment Details
Target: chr7 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 19 - 221
Target Start/End: Complemental strand, 47306456 - 47306253
Alignment:
19 atgaagaccttaacaagtaaatgaaataagcaaaacaatg-ttaattgaaaagaaaattcagaaattcattactacaaattccttgcttctttagctata 117  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||    
47306456 atgaagaccttaacaagtaaatgaaataagcaaaacaatggttaattgaaaagaaaattcagaaattcattgctacaatttccttgcttctttagctata 47306357  T
118 gatattgaattaattcaaccgaaaaaacaaaacaataattgaatgaaagtgaagtaggtagggtaggtaccttgccgtcgggatgaaaacaagggtggat 217  Q
    |||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47306356 gatattgaatttcttcaaccgaaaaaacaaaacaataattgaatgaaagtgaagtaggtagggtaggtaccttgccgtcgggatgaaaacaagggtggat 47306257  T
218 gatg 221  Q
    ||||    
47306256 gatg 47306253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University