View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5019-Insertion-10 (Length: 382)
Name: NF5019-Insertion-10
Description: NF5019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5019-Insertion-10 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 338; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 338; E-Value: 0
Query Start/End: Original strand, 8 - 382
Target Start/End: Original strand, 3852637 - 3853011
Alignment:
| Q |
8 |
ttcttctttgacagcaacattgatcttccatttatctcttgatagcaacatgagggttatagcagcttcttcttcaggggcaaagttgaaaagtgaagta |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3852637 |
ttcttctttgacagcaacattgatcttccatttatctcttgatagcatcatgagggttatagcagcttcttcttcaggggaaaagttgaaaagtgaagta |
3852736 |
T |
 |
| Q |
108 |
acaggttctggttcagcttctgttagtggtgaatgtgaatttgttaaagtctgtttaagcttcttttgtactgagttttggccaaaggtgagttttcttt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3852737 |
acaggttctggttcagcttctgttagtggtgaatgtgaatttgttaaagtctgtttaagcttcttttgtactgagttttggccaaaggtgagttttcttt |
3852836 |
T |
 |
| Q |
208 |
tttgagttgggttctttgactcggtttcactctctctgtcatggacaatagtttctgtagttgagaaataaaacttgggatctgaaagtttgaaacnnnn |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3852837 |
tttgagttgggttctttgactcggtttcactctctctgtcatgaacaatagtttctgtagttgagaaataaaacttgggatctgaaagtttgaaactttt |
3852936 |
T |
 |
| Q |
308 |
nnngggattttctctcaacctatacattagactcttttcatttgagtctctttgttctactgtttgttggttttg |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3852937 |
tttgggattttctctcaacctatacattagactcttttcatttgagtctctctgttctactgtttgttggttttg |
3853011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University