View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5019-Insertion-11 (Length: 284)
Name: NF5019-Insertion-11
Description: NF5019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5019-Insertion-11 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 8 - 284
Target Start/End: Complemental strand, 2694359 - 2694081
Alignment:
| Q |
8 |
aataaatggtgaacatcctataaattgaaagttattcttttctcatgatgcttttccaacgtaattcaaactccctcataaaggatcaacttgcgccata |
107 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||| ||| || |
|
|
| T |
2694359 |
aataaatggtaaacatcctataaattgaaagttattcttttctcatgatgcttttacaacgtaaatcaaactccctcataaaggatcaactt--gccgta |
2694262 |
T |
 |
| Q |
108 |
ttattggaagagt----gtgatggccggtgaattgttgtcactgctattttaccatcctatgataaaaggtttcattttgagaagataccatgatagttc |
203 |
Q |
| |
|
|||||| |||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2694261 |
ttattgaaagagtctacatgatggtcggtgaattgttgtcactgctattttaccatcctatgataaaaggtttcattatgagaagataccatgatagttc |
2694162 |
T |
 |
| Q |
204 |
atcactaaagcatggaatttaatatctccttctcagccgccagaagcctcccagcgcctccctcttctcctcgactcactc |
284 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2694161 |
atcactaaagcatggaacttaatatctccttctcagctgccagaagcctcccagcgcctccctcttctcctcgactcactc |
2694081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 15 - 83
Target Start/End: Complemental strand, 24127230 - 24127162
Alignment:
| Q |
15 |
ggtgaacatcctataaattgaaagttattcttttctcatgatgcttttccaacgtaattcaaactccct |
83 |
Q |
| |
|
||||||||||||||| ||||||||| |||| | || |||||||||||||| |||| |||||||||| |
|
|
| T |
24127230 |
ggtgaacatcctatagattgaaagtaattcatcacttctgatgcttttccaaagtaaagcaaactccct |
24127162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University