View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5019-Insertion-12 (Length: 65)
Name: NF5019-Insertion-12
Description: NF5019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5019-Insertion-12 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
| [»] scaffold0057 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 58; Significance: 3e-25; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 58; E-Value: 3e-25
Query Start/End: Original strand, 8 - 65
Target Start/End: Original strand, 34787249 - 34787306
Alignment:
| Q |
8 |
gtgttttgttttatataaaaggtaaatttagtagtttgtgttttgttttgcctttaca |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34787249 |
gtgttttgttttatataaaaggtaaatttagtagtttgtgttttgttttgcctttaca |
34787306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.0000000003
Query Start/End: Original strand, 8 - 48
Target Start/End: Original strand, 34787115 - 34787155
Alignment:
| Q |
8 |
gtgttttgttttatataaaaggtaaatttagtagtttgtgt |
48 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34787115 |
gtgttttgttttatataaaaggtaaatacagtagtttgtgt |
34787155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 29; Significance: 0.00000007; HSPs: 1)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 29; E-Value: 0.00000007
Query Start/End: Original strand, 8 - 48
Target Start/End: Original strand, 39512 - 39552
Alignment:
| Q |
8 |
gtgttttgttttatataaaaggtaaatttagtagtttgtgt |
48 |
Q |
| |
|
||||||||||||||||||| | ||||||| ||||||||||| |
|
|
| T |
39512 |
gtgttttgttttatataaaggataaatttggtagtttgtgt |
39552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.00000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.00000007
Query Start/End: Original strand, 9 - 49
Target Start/End: Complemental strand, 33573669 - 33573629
Alignment:
| Q |
9 |
tgttttgttttatataaaaggtaaatttagtagtttgtgtt |
49 |
Q |
| |
|
|||||||||||||||||| ||||| ||| |||||||||||| |
|
|
| T |
33573669 |
tgttttgttttatataaagggtaatttttgtagtttgtgtt |
33573629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.00000007; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.00000007
Query Start/End: Original strand, 8 - 48
Target Start/End: Complemental strand, 24128032 - 24127992
Alignment:
| Q |
8 |
gtgttttgttttatataaaaggtaaatttagtagtttgtgt |
48 |
Q |
| |
|
||||||||||||||||||||| ||||||| | ||||||||| |
|
|
| T |
24128032 |
gtgttttgttttatataaaagataaatttggaagtttgtgt |
24127992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.00000007
Query Start/End: Original strand, 8 - 48
Target Start/End: Original strand, 40606903 - 40606943
Alignment:
| Q |
8 |
gtgttttgttttatataaaaggtaaatttagtagtttgtgt |
48 |
Q |
| |
|
|||| |||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
40606903 |
gtgtattgttttatataaagggtaaatttggtagtttgtgt |
40606943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University