View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5019-Insertion-8 (Length: 394)
Name: NF5019-Insertion-8
Description: NF5019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5019-Insertion-8 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 371; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 371; E-Value: 0
Query Start/End: Original strand, 8 - 394
Target Start/End: Complemental strand, 3598398 - 3598012
Alignment:
| Q |
8 |
ttttctgcaccaactgcttggtcttttgcaacatttacaggattttctgccccacctgcttgattgcttataggattttctgtagtaggagtggcctggt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3598398 |
ttttctgcaccaactgcttggtcttttgcaacatttacaggattttctgccccacctgcttgattgcttataggattttctgtagtaggagtggcctggt |
3598299 |
T |
|
| Q |
108 |
ttacaggattctcggcaacactagctgcattgtttgcaagatcttcacctgcacccattgcggaagaatccaaaattccaggtacagaaatgatttacta |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3598298 |
ttacaggattctcggcaacactagctgcattgtttgcaagatcttcacctgcacccattgcggaagaatccaaaattccaggtacagaaatgatttacta |
3598199 |
T |
|
| Q |
208 |
atcaaattccctttatctttaactttagtacctggaaaagcaaggatcattcaaattaattcttgatcataactacaaatgaaaacgttttattgctgtc |
307 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3598198 |
atcaaattccctttatctttaacttcagtacctggaaaagcaaggatcattcaaattaattgttgatcataactacaaactaaaacgttttattgctgtc |
3598099 |
T |
|
| Q |
308 |
actcttcctcattccaaggaaggggtagaaatcataaaagaattagttggttaatggcgaggactggtgtcaattagaaaatctcaa |
394 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3598098 |
actcttcctcattccaaggaaggggtagaaatcataaaagaattagttggttaatggcgaggactggtgtcaattagaaaatctcaa |
3598012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University