View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5019_low_10 (Length: 285)
Name: NF5019_low_10
Description: NF5019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5019_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 14 - 271
Target Start/End: Original strand, 3852384 - 3852641
Alignment:
| Q |
14 |
gaacactaggatcatcttcttatgatgaaggtggcaagttgagatcgaaaaaacatagcttcttcttcttcttccaagatggataaaggtgagatttttt |
113 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3852384 |
gaacactaggatcaacttcttatgatgaaggtggcaagttgagatcgaaaaaacatagcttcttcttcttcttccaagatggataaaggtgagatttttt |
3852483 |
T |
 |
| Q |
114 |
gtgaccacctaatgcttgataagaaccaaaaaccttaggacaaaacacacattggaatattttatgatcactactactagttaaggcaagatttgtttca |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3852484 |
gtgaccacctaatgcttgataagaaccaaaaaccttaggacaaaacacacattggaatattttatgatcactactactagttaaagcaagatttgtttca |
3852583 |
T |
 |
| Q |
214 |
ttttgaagacaaatgcttttgtgacttttaaacttcccacaaacttcttgttcttctt |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3852584 |
ttttgaagacaaatgcttttgtgacttttatacttcccacaaacttcttgttcttctt |
3852641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University