View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5019_low_13 (Length: 218)
Name: NF5019_low_13
Description: NF5019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5019_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 3852294 - 3852085
Alignment:
| Q |
1 |
tagaccagaccacgatgatggtgtggtatggataattggatatcactatatatttgagtagttgttttcttactttatgacatttgggtaaagttagtat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3852294 |
tagaccagaccacgatgatggtgtggtatggataattggatatcactatatatttgagtagttgttttcttactttatgacatttgggtaaagttagtat |
3852195 |
T |
|
| Q |
101 |
atgattatta--nnnnnnnngttttaaagtagctaggtaaaagca-ttgtattatctttatcagtagcataacttatgatatatgttttcaccaactgta |
197 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3852194 |
atgattattattttttttttgttttaaagtagctaggtaaaagcatttgtattatctttatcagtagcataacttatgatatatgttttcaccaactgta |
3852095 |
T |
|
| Q |
198 |
tagtatgatg |
207 |
Q |
| |
|
|||||||||| |
|
|
| T |
3852094 |
tagtatgatg |
3852085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University