View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5020_high_7 (Length: 285)
Name: NF5020_high_7
Description: NF5020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5020_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 84; Significance: 6e-40; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 16 - 140
Target Start/End: Complemental strand, 23895570 - 23895437
Alignment:
| Q |
16 |
agatggatagagagtggtgtggtgtgtagtgttttctagatcatttcatttttaagttttatctttacaaatagatcaattt----------atttttag |
105 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
23895570 |
agatggatagagagtggtgtg-tgtgtagtgttttctagatcatttcatttttaagttttatctttacaaatagatcaatttatttaagtttatttttac |
23895472 |
T |
 |
| Q |
106 |
gttaattaagtaaattgcatgtataaatatttaaa |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
23895471 |
gttaattaagtaaattgcatgtataaatatataaa |
23895437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 219 - 285
Target Start/End: Complemental strand, 23893801 - 23893735
Alignment:
| Q |
219 |
cattgtgatatcaatatattatatcataccaactaattttaaaatattttttctgagtttgttaaac |
285 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23893801 |
cattgtggtatcaatatattatatcataccaactaattttaaaatattttttctgagtttgttaaac |
23893735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University