View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5021-Insertion-10 (Length: 126)
Name: NF5021-Insertion-10
Description: NF5021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5021-Insertion-10 |
 |  |
|
| [»] chr6 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 91; Significance: 2e-44; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 91; E-Value: 2e-44
Query Start/End: Original strand, 8 - 126
Target Start/End: Complemental strand, 30569067 - 30568949
Alignment:
| Q |
8 |
gaaactacatatataatcacatggtaaatataacttacatcattctagtagcagcatcgctgtcttttcatgtccgtatggcatcaccactgcgactgaa |
107 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
30569067 |
gaaattacatatataatcacaaggtaaatataacttacatcattctagtagcagcatcgttgtcttttcatgtctgtatggcgtcaccactgcgactgaa |
30568968 |
T |
 |
| Q |
108 |
gatattcgtttcatgcagt |
126 |
Q |
| |
|
||||| ||| ||||||||| |
|
|
| T |
30568967 |
gatatccgtatcatgcagt |
30568949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 71; E-Value: 1e-32
Query Start/End: Original strand, 8 - 122
Target Start/End: Complemental strand, 30572584 - 30572470
Alignment:
| Q |
8 |
gaaactacatatataatcacatggtaaatataacttacatcattctagtagcagcatcgctgtcttttcatgtccgtatggcatcaccactgcgactgaa |
107 |
Q |
| |
|
|||||||||||| |||||||| ||||| || || ||| | || ||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | |
|
|
| T |
30572584 |
gaaactacatatttaatcacaaggtaagtaaaagttataccaatctagtagcagcatcgctgtcttttcatgtctgtatggcatcaccactgcgactgga |
30572485 |
T |
 |
| Q |
108 |
gatattcgtttcatg |
122 |
Q |
| |
|
||||||||| ||||| |
|
|
| T |
30572484 |
gatattcgtatcatg |
30572470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University