View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5021-Insertion-5 (Length: 515)
Name: NF5021-Insertion-5
Description: NF5021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5021-Insertion-5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 8 - 249
Target Start/End: Original strand, 26777092 - 26777331
Alignment:
| Q |
8 |
accagaactttaaatgatccaccagctccacgtgccggaatgtatgttgcaaccccgccttctggagttggagcttatgctgctcataggatcgggcaac |
107 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
26777092 |
accagaactttaaatgatccaccagttccacctgccggaatgtatgttgtgaccccgccttctggagtcggagtttatgctgctcataggatcgggcaac |
26777191 |
T |
|
| Q |
108 |
ctataggaggacggaattgcactcccggatagatggcttatggtattggaccagtttcttggacaagtatatgccaggggtaacaatgaacttgcgtcct |
207 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||| ||||| |
|
|
| T |
26777192 |
ctataggaggacggaattgcactcccggacagatggcttatggtattggaccagtttcttggacaag--tatgccaggggtaccaatgaacttgggtcct |
26777289 |
T |
|
| Q |
208 |
atgacatttcccatgcaaaatacatatgctcacttatgaagt |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26777290 |
atgacatttcccatgcaaaatacatatgctcacttatgaagt |
26777331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 129 - 249
Target Start/End: Complemental strand, 26553626 - 26553508
Alignment:
| Q |
129 |
ctcccggatagatggcttatggtattggaccagtttcttggacaagtatatgccaggggtaacaatgaacttgcgtcctatgacatttcccatgcaaaat |
228 |
Q |
| |
|
|||||||| | |||| ||||||| |||||||||||||| |||| || ||||||||||||| |||||||| || |||||||||||| | |||||| | || |
|
|
| T |
26553626 |
ctcccggagacatggattatggtcttggaccagtttctgagaca-gt-tatgccaggggtaccaatgaacctgggtcctatgacatatgccatgctacat |
26553529 |
T |
|
| Q |
229 |
acatatgctcacttatgaagt |
249 |
Q |
| |
|
||||||||||| | ||||||| |
|
|
| T |
26553528 |
acatatgctcaatcatgaagt |
26553508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 339 - 397
Target Start/End: Complemental strand, 26552943 - 26552883
Alignment:
| Q |
339 |
agatgatagcaaagtttgtcctaa--atgttactgtgtcatctatattttcatgccctaaa |
397 |
Q |
| |
|
|||||||||||||||||||||||| |||||| || |||||| ||||||| |||| ||||| |
|
|
| T |
26552943 |
agatgatagcaaagtttgtcctaaatatgttattgagtcatccatatttttatgctctaaa |
26552883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 86 - 119
Target Start/End: Complemental strand, 26553699 - 26553666
Alignment:
| Q |
86 |
gctgctcataggatcgggcaacctataggaggac |
119 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
26553699 |
gctgctcctaggatcgggcaacctataggaggac |
26553666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University