View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5021-Insertion-9 (Length: 220)
Name: NF5021-Insertion-9
Description: NF5021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5021-Insertion-9 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 109 - 220
Target Start/End: Original strand, 46556986 - 46557097
Alignment:
| Q |
109 |
gattggttctgtatcaggccataactcagctcgtttaccggtttgtgttaatatcttaatcagtgtatcggtgtcgacagtcccctttacttctactttt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46556986 |
gattggttctgtatcaggccataactcagctcgtttaccggtttgtgttagtatcttaatcagtgtatcggtgtcgacagtcccctttacttctactttt |
46557085 |
T |
|
| Q |
209 |
tgttgcttcaaa |
220 |
Q |
| |
|
|||||||||||| |
|
|
| T |
46557086 |
tgttgcttcaaa |
46557097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University