View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5022-Insertion-15 (Length: 288)
Name: NF5022-Insertion-15
Description: NF5022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5022-Insertion-15 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 8 - 288
Target Start/End: Complemental strand, 9367109 - 9366829
Alignment:
| Q |
8 |
gaaagcgcacaatatgacttccacattcatctattgcttccctaactctcagccagtgacacgtgacaaaatatgagtttaatcaggcttacaggaaaac |
107 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
9367109 |
gaaagcgcacaatatgacttccaccttcatctcttgcttccctaactctcagccagtgacacgtgacgaaatatgagtttaatcaagcttacaggaaaac |
9367010 |
T |
 |
| Q |
108 |
tccttcaatcaagcttaaattattcttaatattgatagtagctgcattggcgatgccgttagatttgggtttaatggattgctttgtcacccttcaaaag |
207 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9367009 |
tccttcaatcaagcttacattattcttaatattgatagtagctgcattggcgatcccgttagagttgggtttaatgggttgctttgtcacccttcaaaag |
9366910 |
T |
 |
| Q |
208 |
tttggagtttaagtttctcaaagctcccctcaagatcctctgaaattcctcaagtcgagcttcaccgcatttatcatggga |
288 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
9366909 |
tttggagtttaagtttctcgaagctcccttcaagatcctctgaaattcctcaagtcgagcttcatcgcatttatcatggga |
9366829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University