View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5022-Insertion-21 (Length: 187)
Name: NF5022-Insertion-21
Description: NF5022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5022-Insertion-21 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 50 - 181
Target Start/End: Complemental strand, 10476194 - 10476063
Alignment:
| Q |
50 |
tggtcattgaatttctataacatattgctggtttgtggtattcaacaagcgaatcacttgagtataaaaagttaacaagcctggtaagcttgttgacaac |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10476194 |
tggtcattgaatttctataacatattgctggtttgtggtattcaacaagcgaatcgcttgagtataaaaagttaacaagcctggtaagcttgttaacaac |
10476095 |
T |
|
| Q |
150 |
atcaaccttcagttattctcctttcaacaatg |
181 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |
|
|
| T |
10476094 |
atcaaccttcagttattctcctgtcaacaatg |
10476063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 66 - 187
Target Start/End: Complemental strand, 38479252 - 38479131
Alignment:
| Q |
66 |
ataacatattgctggtttgtggtattcaacaagcgaatcactt--gagtataaaaa-gttaacaagcctggtaagcttgttgacaacatcaaccttcagt |
162 |
Q |
| |
|
||||||| |||| | |||||| ||||||||||| ||| ||||| ||||||||||| ||||||| || ||| ||||||||||||| |||||||||| |
|
|
| T |
38479252 |
ataacattttgcagatttgtgatattcaacaagtgaagcacttttgagtataaaaaagttaacaggcatggcaagcttgttgaca---tcaaccttcacc |
38479156 |
T |
|
| Q |
163 |
tattctcctttcaacaatggttcaa |
187 |
Q |
| |
|
||||||||| ||||||||||||||| |
|
|
| T |
38479155 |
tattctcctatcaacaatggttcaa |
38479131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University