View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5022_high_12 (Length: 341)
Name: NF5022_high_12
Description: NF5022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5022_high_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 8 - 232
Target Start/End: Original strand, 38699600 - 38699824
Alignment:
| Q |
8 |
attattcttgatctgaactcaactttcaaggtattttcatcgtcctgctgaattannnnnnnccgattggtttcggcgtttgttacatcacaaatattgc |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
38699600 |
attattcttgatctgaactcaactttcaaggtattttcatcgtcctgctgaattatttttttccgattggtttcggcttttgttgcatcacaaatattgc |
38699699 |
T |
|
| Q |
108 |
tctacagataatcttagtttgccagtttgactatatatgatcccttgggttcttcacacttgtttaggattctcgactctcgttgctttcttgctgaatc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38699700 |
tctacagataatcttagtttgccagtttgactatatatgatcccttgggttcttcacacttgtttaggattctcgactctcgtcgctttcttgctgaatc |
38699799 |
T |
|
| Q |
208 |
cctaattttcgcagttcgacgtaac |
232 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
38699800 |
cctaattttcgcagttcgacgtaac |
38699824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University