View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5022_high_29 (Length: 235)
Name: NF5022_high_29
Description: NF5022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5022_high_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 4115098 - 4115309
Alignment:
| Q |
1 |
gagcaaaattttagcaggaatccttgcaatcaggcaacttgagactcataaaaaatcggatatgaccaaattttaagtttaagattagatttaagattca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
4115098 |
gagcaaaattttagcaggaatccttgcaatcaggcaacttgagactcataaaaaatcggatatgaccaaattttaagtttaagattg------------a |
4115185 |
T |
 |
| Q |
101 |
acatagttgatggtgtgtcgttgccgttgacctgtcaagtgtgagtaaatgactttcatgttagatataaatgaacatgaacatcatataagtaaggtga |
200 |
Q |
| |
|
||||||||| ||||||||| |||||||||| |||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4115186 |
acatagttggtggtgtgtcattgccgttgatgtgtcaagtgtgagtaaataactttcatgttagatataaacgaacatgaacatcatataagtaaggtga |
4115285 |
T |
 |
| Q |
201 |
ctacatatttttggtgaggcctat |
224 |
Q |
| |
|
||||||||||||| |||| ||||| |
|
|
| T |
4115286 |
ctacatatttttgttgagacctat |
4115309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University