View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5022_low_15 (Length: 287)

Name: NF5022_low_15
Description: NF5022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5022_low_15
NF5022_low_15
[»] chr3 (1 HSPs)
chr3 (36-284)||(24374996-24375246)
[»] chr1 (1 HSPs)
chr1 (108-287)||(29177093-29177280)
[»] chr5 (3 HSPs)
chr5 (29-192)||(32737227-32737393)
chr5 (213-287)||(41789114-41789188)
chr5 (230-287)||(32737415-32737472)
[»] chr4 (1 HSPs)
chr4 (223-287)||(5824346-5824410)
[»] scaffold0136 (1 HSPs)
scaffold0136 (33-95)||(39771-39833)


Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 36 - 284
Target Start/End: Complemental strand, 24375246 - 24374996
Alignment:
36 ttgagtaaaatgaattttgtagggaagattgttgtgtatcgatttgtagtcggacgaggtgcaatcgttgttagtggtttaggctttttctctctgtttt 135  Q
    ||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||| |||||||| ||||||||| | ||||||||||||    
24375246 ttgagtaaaatgaattttgtagggaagattggtgtgtattgatttgtagtcggacgaggtgcaatcattgttagtagtttaggctctgtctctctgtttt 24375147  T
136 gggttttggaaatggcaagggtgttggtttattgtgttgaggcttttgtttgattttggggc--ttgtggggaagtcttgaatttgaaagttggttttgt 233  Q
    || ||||||||||||||||||||||||| |||  |||||||||||||||||| |||||||||  |||||||||||| |||||||||||||||| ||||||    
24375146 ggattttggaaatggcaagggtgttggtgtatgatgttgaggcttttgtttggttttggggctgttgtggggaagttttgaatttgaaagttgattttgt 24375047  T
234 attgacttgtgtcgggcgaggtgcggatatggtggaaggttgtggtagggg 284  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
24375046 attgacttgtgtcgggcgaggtgcggatatggtggaaggttgtggtagggg 24374996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 108 - 287
Target Start/End: Complemental strand, 29177280 - 29177093
Alignment:
108 agtggtttaggctttttctctctgttttgggttttggaaatggcaagggtgttggtttattgtgttgaggcttttgtttgattttggggct--tgtgggg 205  Q
    |||||||| |||||| |||||||||||||||||| || ||||||| |||||||||  ||| |   ||| ||||||||||| ||||||||||  |||||||    
29177280 agtggtttcggctttgtctctctgttttgggtttcggcaatggcaggggtgttggcgtatggcactgacgcttttgtttggttttggggctgttgtgggg 29177181  T
206 aagtcttg------aatttgaaagttggttttgtattgacttgtgtcgggcgaggtgcggatatggtggaaggttgtggtaggggctg 287  Q
    | |||| |      |||||||||||||||||| ||||| ||||||||||  ||||||| ||| |||||||||||||||||||||||||    
29177180 aggtctcgtgttggaatttgaaagttggttttttattggcttgtgtcggatgaggtgcagatgtggtggaaggttgtggtaggggctg 29177093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 69; Significance: 5e-31; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 29 - 192
Target Start/End: Original strand, 32737227 - 32737393
Alignment:
29 atggagtttgagtaaaatgaattttgtagggaagattgttgtgtatcgatttgtag---tcggacgaggtgcaatcgttgttagtggtttaggctttttc 125  Q
    ||||||||||||||| ||||||||||||||||||||||| ||||||| |||||||    ||| ||||||||  |  ||||  ||||||||  ||||| ||    
32737227 atggagtttgagtaagatgaattttgtagggaagattgtcgtgtatcaatttgtacaaatcgaacgaggtgtgactgttgaaagtggtttcagctttgtc 32737326  T
126 tctctgttttgggttttggaaatggcaagggtgttggtttattgtgttgaggcttttgtttgatttt 192  Q
    ||||||||||||||||||| ||||||| |||||||||| ||| |||||| || ||||||||| ||||    
32737327 tctctgttttgggttttggcaatggcaggggtgttggtgtatggtgttgtggtttttgtttggtttt 32737393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 213 - 287
Target Start/End: Original strand, 41789114 - 41789188
Alignment:
213 gaatttgaaagttggttttgtattgacttgtgtcgggcgaggtgcggatatggtggaaggttgtggtaggggctg 287  Q
    |||||||||||||| ||||||||||| || |||||| ||| |||||||| |||||||||||||||| ||||||||    
41789114 gaatttgaaagttgattttgtattgatttatgtcggacgaagtgcggatgtggtggaaggttgtggcaggggctg 41789188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 230 - 287
Target Start/End: Original strand, 32737415 - 32737472
Alignment:
230 ttgtattgacttgtgtcgggcgaggtgcggatatggtggaaggttgtggtaggggctg 287  Q
    |||||||| |||||||||| ||| |||||||| ||||||||| |||||||||||||||    
32737415 ttgtattggcttgtgtcggacgaagtgcggatgtggtggaagattgtggtaggggctg 32737472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 223 - 287
Target Start/End: Complemental strand, 5824410 - 5824346
Alignment:
223 gttggttttgtattgacttgtgtcgggcgaggtgcggatatggtggaaggttgtggtaggggctg 287  Q
    ||||||||||||||| |||||||||| ||| |||| ||| | |||||||||||||||||||||||    
5824410 gttggttttgtattggcttgtgtcggacgaagtgcagatgtagtggaaggttgtggtaggggctg 5824346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0136 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0136
Description:

Target: scaffold0136; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 33 - 95
Target Start/End: Original strand, 39771 - 39833
Alignment:
33 agtttgagtaaaatgaattttgtagggaagattgttgtgtatcgatttgtagtcggacgaggt 95  Q
    ||||||||| | || ||||||||  ||||||||||| ||||| ||||| ||||||||||||||    
39771 agtttgagtgagataaattttgtcaggaagattgttatgtattgatttatagtcggacgaggt 39833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University