View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5022_low_16 (Length: 281)
Name: NF5022_low_16
Description: NF5022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5022_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 144; Significance: 9e-76; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 144; E-Value: 9e-76
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 14469807 - 14469592
Alignment:
| Q |
1 |
atcatttattttgctcgtaaaaacattctttaccgcctggtcaaatatttactgctcat--tatccaaggattcttggattgttgattttggtcctagtt |
98 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||| | |||||| |||||||| |||| |||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
14469807 |
atcatttatttttctcgtaaaaaaattctttacc--caggtcaaccatttactgttcataatatccatggattcttggattgttgattttggttctagtt |
14469710 |
T |
 |
| Q |
99 |
cacaacttcacatatggcattcctcaattatttcttgtatctcaagatgtttctaatagatttcaagcatcattctttatctttgggtgcttaaagtctc |
198 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
14469709 |
cacaacttcacatatgacattcctcaactatttctagtatctcaagatgtttctaatagatttcaggcatcattctttatctttgggtgcttaaagtcta |
14469610 |
T |
 |
| Q |
199 |
ctgtctcacattatttcg |
216 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
14469609 |
ctgtctcacattatttcg |
14469592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 167 - 247
Target Start/End: Complemental strand, 14484787 - 14484707
Alignment:
| Q |
167 |
atcattctttatctttgggtgcttaaagtctcctgtctcacattatttcgatccattatcacattatttctcttcttcttc |
247 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||||||||||| |||| ||||||||||||||||||||| |||| |
|
|
| T |
14484787 |
atcattctttatctttggatgcttaaagtctcttgtctcacattattttgatctcttatcacattatttctcttctacttc |
14484707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 121 - 161
Target Start/End: Complemental strand, 14484936 - 14484896
Alignment:
| Q |
121 |
ctcaattatttcttgtatctcaagatgtttctaatagattt |
161 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
14484936 |
ctcaattatttctactatctcaaaatgtttctaatagattt |
14484896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University