View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5022_low_18 (Length: 271)
Name: NF5022_low_18
Description: NF5022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5022_low_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 17 - 270
Target Start/End: Original strand, 49976331 - 49976579
Alignment:
| Q |
17 |
atattgtgtgtgcgtgtgtatgatgaagaagggaggtaagtgagagagagtgtagcagaagaactgatagagaactttcaaagctctttatcttctacaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49976331 |
atattgtgtgtgcgtgtgtatgatgaagaagggaggtaagtgagagagagtgtagcagaagaactgatagagaactttcaaagctctttatcttctacaa |
49976430 |
T |
|
| Q |
117 |
tcactcaaactatagcctctacaatatctttttctttctgtagtctctttctgctggtatcatattacaatcaccatgtaggtcttccgtcccccactta |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49976431 |
tcactcaaactatagcctctacaatatctttttctttctgtagtctctttctgctggtatcatattacaatcaccatgtaggtcttccgtcccccactta |
49976530 |
T |
|
| Q |
217 |
ctactacaccttcatagattgatctgatcatcttctcctcttcagcttctactc |
270 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
49976531 |
ctactacaccttcatagat-----tgatcatcttctcctcttcaacttctactc |
49976579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 58 - 124
Target Start/End: Complemental strand, 49954478 - 49954413
Alignment:
| Q |
58 |
gagagagagtgtagcagaagaactgatagagaactttcaaagctctttatcttctacaatcactcaa |
124 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
49954478 |
gagagagag-gtggcagaagaactgatagagaactttcaaagctctttatcttctaccatcactcaa |
49954413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University