View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5022_low_19 (Length: 265)
Name: NF5022_low_19
Description: NF5022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5022_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 250
Target Start/End: Original strand, 6523976 - 6524225
Alignment:
| Q |
1 |
gcagatcaaagactcacacattcaactttatcatggaaagagtcagagctaaattaaaagggtggaaggagaggaatctatccttctcaagaagaggtgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6523976 |
gcagatcaaagactcacacattcaactttatcatggaaagagtcagagctaaattaaaagggtggaaggagaggaatctatccttctcaggaagaggtgt |
6524075 |
T |
 |
| Q |
101 |
tttaatcagagcagttattcaagctttacctacttatgtcatgagtatgttcctcattcccgagggcatttgtgataaaatagagcaggcaatctgcaga |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6524076 |
tttaatcagagcagttattcaagctttgcctacttatgtcatgagtatgttcctcattcccgagggcatttgtgataaaatagagcaggcaatctgcaga |
6524175 |
T |
 |
| Q |
201 |
ttctggtggggaggaaatgaagacagaagaaggatccactggaaacacaa |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
6524176 |
ttctggtggggaggaaatgaagacagaagaaggatccactggaaaaacaa |
6524225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University