View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5022_low_20 (Length: 260)
Name: NF5022_low_20
Description: NF5022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5022_low_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 108; Significance: 3e-54; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 3 - 178
Target Start/End: Original strand, 14469872 - 14470046
Alignment:
| Q |
3 |
cttgatgatcacattgatttccttagatacttgctacaccaaacgtgttttcgtagaatccaagaaaaagcaaagtcggtacttaaccatgtagccaaga |
102 |
Q |
| |
|
||||||||| |||||||| |||||| || ||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| | ||||| |
|
|
| T |
14469872 |
cttgatgatgacattgatctccttaaatgcttgctacaccaaacatgtttccgtagaatccaagaaaaagcaaagtcggtacttaaccatgt-gtcaaga |
14469970 |
T |
|
| Q |
103 |
aatcagaaagaccagagttgtggtattttactaccttcaaggccataacaaaatagtagaaatatacatgtattgt |
178 |
Q |
| |
|
| |||||| |||||||| |||||||||||| |||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
14469971 |
taacagaaatgccagagttttggtattttactgccttcaaggccagaacaaaatagtagaaatatgcatgtattgt |
14470046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University