View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5022_low_24 (Length: 243)
Name: NF5022_low_24
Description: NF5022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5022_low_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 51 - 211
Target Start/End: Original strand, 45684867 - 45685027
Alignment:
| Q |
51 |
aagaatgcatacagcaaggaccatggagtttggcagaataaacaaatagcttgtaagcctattagatatattaagcatgtaacaaaattatggacattgt |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45684867 |
aagaatgcatacagcaaggaccatggagtttggcagaataaacaaatagcttgtaagcctattagatatattaagcatgtaacaaaattatggacattgt |
45684966 |
T |
 |
| Q |
151 |
taactagtttgtagctcattaggcattgggtgagtttcaatctttttctcttatacctatg |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45684967 |
taactagtttgtagctcattaggcattgggtgagtttcaatctttttctcttatacctatg |
45685027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University