View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5023-Insertion-15 (Length: 317)
Name: NF5023-Insertion-15
Description: NF5023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5023-Insertion-15 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 8 - 317
Target Start/End: Original strand, 31455140 - 31455449
Alignment:
| Q |
8 |
tttagatgcatgtagttcatcaagggaattactcttgaatctcaaggaacatgtggaaacacttcaatccgctatacgtagaagacgaggaaattcaact |
107 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31455140 |
tttagatgcatgtggttcatcaagggaattactcttgaatctcaaggaacatgtggaaacacttcaatcggctatacgtagaagacgaggaaattcaact |
31455239 |
T |
|
| Q |
108 |
tcaagcattgaaagcagcatatatgagtatgattgctttagaaagaaggcaaagaaggaaatttctaagcaacttagtgaaatgaagaaaatggaaaaca |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
31455240 |
tcaagcattgaaagcagcatatatgagtatgattgctttagaaagaaggcaaagaaggaaatttcaaagcaacttggtgaaatgaagaaaatggaaaaca |
31455339 |
T |
|
| Q |
208 |
aagtaaagcttttttctattatgggacaagatcaaaatttaatatttttggctaaggttttaagagaagctaccaccatcacaatatctatatttcgttc |
307 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31455340 |
aagtaaagcttttttctattatgggccaagatcaaaatttaatatttttggctaaggttttaagagaagctaccaccatcacaatatctatatttcgttc |
31455439 |
T |
|
| Q |
308 |
tcttttacta |
317 |
Q |
| |
|
|||||||||| |
|
|
| T |
31455440 |
tcttttacta |
31455449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University