View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5023-Insertion-5 (Length: 93)
Name: NF5023-Insertion-5
Description: NF5023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5023-Insertion-5 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 82; Significance: 3e-39; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 82; E-Value: 3e-39
Query Start/End: Original strand, 8 - 93
Target Start/End: Complemental strand, 8429915 - 8429830
Alignment:
| Q |
8 |
gtaatcaacttctataattagtcagaacatgctttggcatgtaatgagaaatgaggtacatctcacatctctctatcttgttctaa |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8429915 |
gtaatcaacttctataattagtcagaacatgctttggcatgtaatgagaaatgaggtatatctcacatctctctatcttgttctaa |
8429830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University