View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5023_high_13 (Length: 203)
Name: NF5023_high_13
Description: NF5023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5023_high_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 142 - 196
Target Start/End: Original strand, 38344634 - 38344688
Alignment:
| Q |
142 |
caattgtttccattgcattattttaggggaattatttccattatattcttcgaca |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38344634 |
caattgtttccattgcattattttaggggaattatttccattatattgttcgaca |
38344688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University