View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5023_high_6 (Length: 354)
Name: NF5023_high_6
Description: NF5023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5023_high_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 144; Significance: 1e-75; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 107 - 266
Target Start/End: Original strand, 34020804 - 34020963
Alignment:
| Q |
107 |
aatttggttgtttaggagtgttccttaaaaggatccgtttttgttttcaattgatttggatgacatgtgattgattttatttggaaggaaaaaagttatc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34020804 |
aatttggttgtttaggagtgttccttaaaaggatccgtttttgttttcaattgatttggatgacatgtgattgattttatttggaaggaaaaaagttatc |
34020903 |
T |
|
| Q |
207 |
gtattttttaacataaggagtcttcagttcagcaatttttagacaaagtgaaagtttaag |
266 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||||| ||| |||||||||||| |
|
|
| T |
34020904 |
gtatttttcaacataaggagtcttcagttcagcaattgttagataaaatgaaagtttaag |
34020963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 32 - 188
Target Start/End: Complemental strand, 35806416 - 35806260
Alignment:
| Q |
32 |
ccatatttggtcgctagtttttcgatggttaagcatattttcggcgcttttggtgtgttattgatcatcttattcaatttggttgtttaggagtgttcct |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |||||||||||||||||||| |||||| || |
|
|
| T |
35806416 |
ccatatttggtcgctagtttttcgatggttaagcatattttcagcgctttcagtgtgttattgatcatcgtattcaatttggttgtttagcagtgtttct |
35806317 |
T |
|
| Q |
132 |
taaaaggatccgtttttgttttcaattgatttggatgacatgtgattgattttattt |
188 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35806316 |
taaaaggatccgtttttattttcaattgatttggatgacatgtgattgattttattt |
35806260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University