View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5024-Insertion-12 (Length: 159)
Name: NF5024-Insertion-12
Description: NF5024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5024-Insertion-12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 70; Significance: 7e-32; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 70; E-Value: 7e-32
Query Start/End: Original strand, 61 - 158
Target Start/End: Original strand, 10851526 - 10851623
Alignment:
| Q |
61 |
aaaccgcggcgccgcaaattagaatcagaccgaacctaactgcagatcctta--aaaagttgatgttgaactcagctctgtgtgtgttccttgaaacatg |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10851526 |
aaaccgcggcgccgcaaattagaatcagaccgaacctaactgcagatccttattttaagttgatgttgaactcag--ctgtgtgtgttccttgaaacatg |
10851623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 65; E-Value: 7e-29
Query Start/End: Original strand, 8 - 80
Target Start/End: Original strand, 10865057 - 10865129
Alignment:
| Q |
8 |
ggtggtggtggcggtagtggaagatattttgaagaagaaaaccactgtggctgaaaccgcggcgccgcaaatt |
80 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
10865057 |
ggtggtggcggcggtagtggaagatattttgaagaagaaaaccgctgtggctgaaaccgcggcgccgcaaatt |
10865129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 13 - 43
Target Start/End: Original strand, 10851496 - 10851526
Alignment:
| Q |
13 |
tggtggcggtagtggaagatattttgaagaa |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
10851496 |
tggtggcggtagtggaagatattttgaagaa |
10851526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University