View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5024-Insertion-14 (Length: 359)
Name: NF5024-Insertion-14
Description: NF5024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5024-Insertion-14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 109 - 356
Target Start/End: Original strand, 46556986 - 46557234
Alignment:
| Q |
109 |
gattggtcctgtatcaggccataactcagctcgtttaccggtttgtgttagtatcttaatcagtgtatcggtgtcgacagtcccctttacttctactttt |
208 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46556986 |
gattggttctgtatcaggccataactcagctcgtttaccggtttgtgttagtatcttaatcagtgtatcggtgtcgacagtcccctttacttctactttt |
46557085 |
T |
|
| Q |
209 |
tgttgcttcaaatcaatagttgtttgataaacacctgatttaacaacaatattaacaagggttttgaaatgaaaacaaaaaataacatatattgagtttt |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46557086 |
tgttgcttcaaatcaatagttgtttgataaacacctgatttaacaacaatattaacaagagttttgaaatgaaaacaaaaaataacatatattgagtttt |
46557185 |
T |
|
| Q |
309 |
gaatgttattga-tttgttaccatctatgctttggaggacttttttgac |
356 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
46557186 |
gaatgttattgattttgttaccatctatgctttggaggacttttttgac |
46557234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University