View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5026-Insertion-14 (Length: 324)
Name: NF5026-Insertion-14
Description: NF5026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5026-Insertion-14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 106; Significance: 5e-53; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 25 - 217
Target Start/End: Original strand, 17322381 - 17322574
Alignment:
| Q |
25 |
gacgagaattgttcttctctcttttggtttat-ttgtttcccttaaaaatgtttaatgtgaattaactgacgtaagcataaaagtaaagggggacgagca |
123 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||| |||||||||| ||||| ||| ||| ||| ||||||| |||||||| | ||||||| | |
|
|
| T |
17322381 |
gacgagaattgttcttctctcttttgattttgcttgttctccttaaaaatatttaagatgagttagttgatgtaagcacaaaagtaaggcaggacgagta |
17322480 |
T |
 |
| Q |
124 |
aaatcaaacgggagaagatcaattctccacgaagacaccacttagaatttcaaagcaaaggttaactttgtttttgactcataacacaagttaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| ||||||| |
|
|
| T |
17322481 |
aaatcaaacgggagaagatcaattctccacgaagacaccacttagaatttcaaagcaaaggttaattttgttttcgactcataacaaaagttaa |
17322574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University