View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5026-Insertion-17 (Length: 268)
Name: NF5026-Insertion-17
Description: NF5026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5026-Insertion-17 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 8 - 268
Target Start/End: Complemental strand, 37489277 - 37489017
Alignment:
| Q |
8 |
gacagacgatgaacttatgcagaagctagaagagttgacaatggatgcaaaacatcaccagttggaaactcttcgatcaatccttcaacataatggttct |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37489277 |
gacagacgatgaacttatgcagaagctagaagagttgacaatggatgcaaaacatcaccagttggaaactcttcgatcaatccttcaacataatggttct |
37489178 |
T |
 |
| Q |
108 |
gttagatatcttcaatctttgaataataacaaaagtgttgatcctgctactttcacaagtcttgttcctttgtcttcctatgatgattacgttgacttta |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37489177 |
gttagatatcttcaatctttgaataataacaaaagtgttgatcctgctactttcacaagtcttgttcctttgtcttcctatgatgattacgttgacttta |
37489078 |
T |
 |
| Q |
208 |
tccaccagatggctgatggagaacatgatgatcatcatgatcttctctctgttgatcctct |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37489077 |
tccaccagatggctgatggagaacatgatgatcatcatgatcttctctctgttgatcctct |
37489017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University