View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5026_high_16 (Length: 240)

Name: NF5026_high_16
Description: NF5026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5026_high_16
NF5026_high_16
[»] chr3 (1 HSPs)
chr3 (1-223)||(53462699-53462921)


Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 53462921 - 53462699
Alignment:
1 actctgagggtcaagttttgctctacatagaggacacatagggtgtttggagagccacgtgtcggcacattggagatgaaaagcgtggttacaaccgggt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53462921 actctgagggtcaagttttgctctacatagaggacacatagggtgtttggagagccacgtgtcggcacattggagatgaaaagcgtggttacaaccgggt 53462822  T
101 aacagacgagccggttgttcatcaacgatatcgtcaaggcaaacggcgcattcggtgggcgcgagcaattccttaccggtgattttaggaagcttttcaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53462821 aacagacgagccggttgttcatcaacgatatcgtcaaggcaaacggcgcattcggtgggcgcgagcaattccttaccggtgattttaggaagcttttcaa 53462722  T
201 gatctaaaggggagagacccttt 223  Q
    |||||||||||||||||||||||    
53462721 gatctaaaggggagagacccttt 53462699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University