View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5026_high_19 (Length: 233)
Name: NF5026_high_19
Description: NF5026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5026_high_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 17 - 214
Target Start/End: Original strand, 41689635 - 41689832
Alignment:
| Q |
17 |
cagagatagacccatttgatgaacgcagaagaatgctaataactgacgaaaaaatctgttacagttgtacaaaatcagtcttgaatcagataattctcgc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41689635 |
cagagatagacccatttgatgaacgcagaagaatgctaataactgacgaaaaaatctgttacagttgtacaaaatcagtcttgaatcagataattctcgc |
41689734 |
T |
 |
| Q |
117 |
taagggcaagtcgacatcaaacaaagaaactataaaagtgtatcaaccaattcaacaaaaattgtgaattttcatacctacttgcagctggagcaaac |
214 |
Q |
| |
|
|| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41689735 |
tactggcaagtcgacataaaacaaagaaactataaaagtgtatcaaccaattcaacaaaaattgtgaattttcatacctacttgcagctggagcaaac |
41689832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University