View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5026_low_12 (Length: 290)
Name: NF5026_low_12
Description: NF5026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5026_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 24 - 271
Target Start/End: Original strand, 37814806 - 37815053
Alignment:
| Q |
24 |
atgaacgagagaaggaacgatgtaaccccaaacaaagcgcccgaaagcagccaagaagccaacaaaatcaatgcaactcatcaacgccccttcacaaatc |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37814806 |
atgaacgagagaaggaacgatgtaaccccaaacaaagcgcccgaaagcagccaagaagccaacaaaatcaatgcaactcatcaacgccccttcacaaatc |
37814905 |
T |
 |
| Q |
124 |
tctctatcttccaacacaagaaaggttccaccttccgctcatagtacatgaatcttacctagaaaccatttccacgaggagaattataccttatcaacca |
223 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
37814906 |
tctctatcttccaacagaagaaaggttccaccttccgctcatagtacatgaatcttacctagaaaccatttccaagaggagaattataccttatcaacca |
37815005 |
T |
 |
| Q |
224 |
aatgctccctataggtaatcctcccgtaggagattagaccgtttcatg |
271 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
37815006 |
aatgctccctagaggtaatcctcccataggagattagaccgtttcatg |
37815053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University