View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5026_low_14 (Length: 261)
Name: NF5026_low_14
Description: NF5026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5026_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 251
Target Start/End: Complemental strand, 23382739 - 23382487
Alignment:
| Q |
1 |
agtgcaaaacacccaaaagttttggtatgtgatgtttatccttcattacttaaagtatatgctattcaacctcattagacccataatgcttatataa--a |
98 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||| | |
|
|
| T |
23382739 |
agtgcaaaacacccaaaagttttggtatgaaatgtttatccttcattacttaaagtatatgctattcaacctcattagatccatgatgcttatataatta |
23382640 |
T |
|
| Q |
99 |
atttctatttcaggtggttcagattgaaagaagaatttcagctgtcaccggcttcgttcacagctttcttctgcgattaacattcgatcttgctctccaa |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
23382639 |
atttctatttcaggtggttcagattgaaagaagaatttcagctgtcaccggcttcgttcacagccttcttctgcgattaacattcgatcttgctctccaa |
23382540 |
T |
|
| Q |
199 |
agtgttgagtgatcatggacaaaggtcctttgttagcatcatcacagcctttg |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23382539 |
agtgttgagtgatcatggacaaaggtcctttgttagcatcatcacagcctttg |
23382487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University