View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5029_high_9 (Length: 385)
Name: NF5029_high_9
Description: NF5029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5029_high_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 9e-89; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 9e-89
Query Start/End: Original strand, 99 - 280
Target Start/End: Complemental strand, 13356532 - 13356351
Alignment:
| Q |
99 |
tatcataacttccttatcatggtgctgctggtgcaacatggagacgacgacggttatgttggtgatgatgaagttgatgatttttattaaccttatggat |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13356532 |
tatcataacttccttatcatggtgctgctggtgcaacatggagacgacgacggttatgttggtgatgatgaagttgatgatttttattaaccttatggat |
13356433 |
T |
|
| Q |
199 |
gatattatggtgcagcatggagctatcgtaatagcatgatcgtagtttaccaattctttgagagtggtttcatgtttaattt |
280 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13356432 |
gatatcgtggtgcagcatggagctatagtaatagcatgatcgtaatttaccaattctttgagagtggtttcatgtttaattt |
13356351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 278 - 376
Target Start/End: Complemental strand, 13356115 - 13356017
Alignment:
| Q |
278 |
tttaaatctagtgctagtatgtgcacttggattggattgtatcttcgtaaactctctttcaatttcctaagcaaaaatcgtccgtattgtgagtattat |
376 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
13356115 |
tttaaatctagtgctagtatgtgcacttggattagattgtatcttcgtaaactctctttcaatttcctaagcaaaaatcgtcggtattgtgaatattat |
13356017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 16 - 44
Target Start/End: Complemental strand, 13356600 - 13356572
Alignment:
| Q |
16 |
agaatgtagtggaatatgtactaaacaac |
44 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
13356600 |
agaatgtagtggaatatgtactaaacaac |
13356572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 333 - 376
Target Start/End: Original strand, 35167157 - 35167200
Alignment:
| Q |
333 |
ctttcaatttcctaagcaaaaatcgtccgtattgtgagtattat |
376 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
35167157 |
ctttcaacttcctaagcaaaaatcgtcggtattatgagtattat |
35167200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University