View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5029_low_15 (Length: 312)
Name: NF5029_low_15
Description: NF5029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5029_low_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 102; Significance: 1e-50; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 1 - 196
Target Start/End: Complemental strand, 12812323 - 12812127
Alignment:
| Q |
1 |
aaataggaaaaagagaataatataaaaattaagaataatttttgtttccannnnnnngtnnnnnnn-gttctcaagtgtgtgtgtccctttttatatagc |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| ||||||||||||||| |
|
|
| T |
12812323 |
aaataggaaaaagagaataatataaaaattaagaataatttttgtttccatttttttgtaaaaaaaagttctcaagtgtgtgt--ccctttttatatagc |
12812226 |
T |
|
| Q |
100 |
acacaaactttcatttctcactacaaaaatttatattctctc--tcnnnnnnnccatattgcactaaatcactataaataaagttagagtttatttctt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12812225 |
acacaaactttcatttctcactacaaaaatttatattctctctttttttttttccatattgcactaaatcactataaataaagttagagtttatttctt |
12812127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 279 - 312
Target Start/End: Complemental strand, 12812044 - 12812011
Alignment:
| Q |
279 |
ccggcaggtaactttctcaaaaagaagaaatggt |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
12812044 |
ccggcaggtaactttctcaaaaagaagaaatggt |
12812011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University