View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5030-Insertion-11 (Length: 189)
Name: NF5030-Insertion-11
Description: NF5030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5030-Insertion-11 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 9 - 173
Target Start/End: Complemental strand, 4581775 - 4581611
Alignment:
| Q |
9 |
aatgattgccattattcatcaccaaatttttattcagctacagactaatttaaatgctgtcacatgacatgttttttggcattatgattagagttgttag |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4581775 |
aatgattgccattattcatcaccaaatttttattcagctacagactaatttaaacgctgtcacatgacatgttttttggcattatgattagagttgttag |
4581676 |
T |
|
| Q |
109 |
gtaggtgtattgttggcactggcttatccctttatctctaaacctcaagtcatacacatactata |
173 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4581675 |
gtaggtgtattgttggcactggctaatccctttatctctaaacctcaagtcatacacatactata |
4581611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 9 - 104
Target Start/End: Complemental strand, 4590187 - 4590091
Alignment:
| Q |
9 |
aatgattgccattattcatcaccaaatttttattcagctacagactaatttaaatgctgtcacatgacatgtttt-ttggcattatgattagagttg |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||| |||||||||||||||||||| | |||||||||||| |||||||||||| |||||||| |
|
|
| T |
4590187 |
aatgattgccattattcatcaccaaatttttcatctgcttcagactaatttaaatgctgtgatatgacatgttttgttggcattatgactagagttg |
4590091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University