View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5030_low_4 (Length: 378)
Name: NF5030_low_4
Description: NF5030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5030_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 19 - 323
Target Start/End: Complemental strand, 18442557 - 18442233
Alignment:
| Q |
19 |
tataggttggtcgaacatacttcatacaaagataccgacactctttgttagtcttaaactgtgtgatggcaaattggttttgtgaaggtcatctgctact |
118 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
18442557 |
tataggttggtcgaacatgcttcatacaaagataccgactatctttgttagtcttaaactgtgtgatggtaaattggttctgtgaaggtcatctgctact |
18442458 |
T |
 |
| Q |
119 |
ctagttcttttcacatggtgcaattggtaactttgggcacacatgactttcattattatatcaatatgttggagattattagagattacttaaaaaacat |
218 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18442457 |
ctagttcttttcacggggtgcaattgataactttgggcacacatgactttcattattataccaatatgttggagattattagagattacttaaaaaacat |
18442358 |
T |
 |
| Q |
219 |
tggaatttcaccttccaccacattcttc--------------------ttcgtgagggaaatacttgtgcagaattttcagcgaagttaggagatgattg |
298 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
18442357 |
tggaatttcaccttccaccacattcttcgtgagagaaatacttgtgcattcgtgagagaaatacttgtgcagattttccagcgaagttaggagatgattg |
18442258 |
T |
 |
| Q |
299 |
tatggataccttgattatggttcat |
323 |
Q |
| |
|
||||||||||||| ||||||||||| |
|
|
| T |
18442257 |
tatggataccttggttatggttcat |
18442233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University