View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5031-Insertion-10 (Length: 224)
Name: NF5031-Insertion-10
Description: NF5031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5031-Insertion-10 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 8 - 206
Target Start/End: Complemental strand, 34891563 - 34891365
Alignment:
| Q |
8 |
aattcgacattgacaccgatgaagattcgaccggagattccaactgcgacggccgcaacgtggaatttggagatagggacacgggctaatggttgggatg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34891563 |
aattcgacattgacaccgatgaagattcgaccggagattccaactgcgacggccgcaacatggaatttggagatagggacacgggctaatggttgggatg |
34891464 |
T |
|
| Q |
108 |
atttgacaatggtggggaggagttgggttagggttaggtttgttgattgggttaatgattttgcttctgatacttctattatgaatttaggttcttcca |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34891463 |
atttgacaatggtggggaggagttgggttagggttaggtttgttgattgggttaatgattttgcttctgatacttctattatgaatttaggttcttcca |
34891365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University